| Primary Identifier | MGI:7423616 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(9Rr207838-Rr207840)8Vmc |
| Strain of Origin | FVB/NRj | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The super-enhancer between Exog and Scn5a, containing cardiac-specific Scn5a enhancers Rr207838, Rr207839 and Rr207840, was targeted with sgRNAs (targeting GGTCTGAGTACCGTAGATGA and GGGAGCCGAGGGCGCTCCTT) using CRISPR/Cas9 technology, resulting in an ~12.2 kb deletion. |
