| Primary Identifier | MGI:7425017 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Mtmr6 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TAGCCATTTCTTTGAAGAAG and ACAGTGCTGAGGGCAGTGTG, which resulted in a 277 bp deletion beginning at Chromosome 14 position 60,281,868 bp and ending after 60,282,144 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000558120 (exon 4) and 119 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 101 and early truncation 2 amino acids later. There is a single bp A insertion at the deletion site. |
