| Primary Identifier | MGI:7407295 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | In(11)2Smun |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Border (insulator) region Rr325 in In(11Rr325)1Smun inversion allele ES cells (originally located between the Kcnj and Sox9 topologically associated domains (TADs)), was targeted with sgRNAs (targeting ATCCCGAAATTAAACTGCCC and CTTCTTAACAAAAACCGAAC) using CRISPR/Cas9 technology, resulting in its deletion. |
