|  Help  |  About  |  Contact Us

Allele : Rr231594<em1Smun> regulatory region 231594; endonuclease-mediated mutation 1, Stefan Mundlos

Primary Identifier  MGI:7407306 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr231594
Strain of Origin  Not Specified Is Recombinase  false
Is Wild Type  false
molecularNote  The CTCF-binding site in the Sox9 topologically associated domain (TAD) was targeted with an sgRNA (targeting TGGATTCCAAAAGAGGGCAG) using CRISPR/Cas9 technology, resulting in its deletion.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • deltaC1,
  • deltaC1
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele