| Primary Identifier | MGI:7408173 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Adat2 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATATCATAAACTCACCAACA and ATGCAGCAAGTACAAGAGCC, which resulted in a 476 bp deletion beginning at Chromosome 10 position 13,435,665 bp and ending after 13,436,140 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000098195 (exon 3) and 325 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 67 and early truncation 20 amino acids later. |
