|  Help  |  About  |  Contact Us

Allele : Hs1bp3<em1(IMPC)J> HCLS1 binding protein 3; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7408175 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Hs1bp3
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTTCGTCTGACGTTCCCCA and AGACCTTGAACAAATGACAT, which resulted in a 463 bp deletion beginning at Chromosome 12 position 8,373,662 bp and ending after 8,374,124 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000106987 (exon 4) and 231 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 135 and early truncation 12 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele