|  Help  |  About  |  Contact Us

Allele : Rr329<em1Mam> regulatory region 329; endonuclease-mediated mutation 1, Lothar Hennighausen

Primary Identifier  MGI:7408217 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr329
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  TALEN-targeting deleted 26 bp (TTGGCTGCTTGAGTTTCCCAGAAGGC), which includes the interferon–activated sequence (GAS) motif, within the E2 enhancer (part of Wap super enhancer) upstream of Wap.
  • mutations:
  • Intragenic deletion
  • synonyms:
  • GAS<deltaE2>,
  • GAS<deltaE2>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele