|  Help  |  About  |  Contact Us

Allele : Cacng4<em1(IMPC)J> calcium channel, voltage-dependent, gamma subunit 4; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7411389 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Cacng4
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTCACACGGGAGTCGTCCGC and TGATACCGATGATATTACTG, which resulted in a 516 bp deletion beginning at Chromosome 11 position 107,734,797 bp and ending after 107,735,312 bp (GRCm38/mm10). This mutation deletes 516 bp from ENSMUSE00000370668 (exon 4) and is predicted to delete 172 amino acids after amino acid residue 150 and then terminate 5 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele