| Primary Identifier | MGI:7411391 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Kcnk12 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGGCATCATGAACAACCGGC and GCCTTCCCGCCCACTGTGGC, which resulted in a 870 bp deletion beginning at Chromosome 17 position 87,745,950 bp and ending after 87,746,819 bp (GRCm38/mm10). This mutation deletes 870 bp from ENSMUSE00000336157 (exon 2) and is predicted to cause a 290 amino acid deletion beginning after amino acid residue 137 and termination 3 amino acids later. |
