| Primary Identifier | MGI:7411378 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Gabrp |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCCTCGACTGAAAGACCGTG and GCCGGTGTATCTACATTAGT, which resulted in a 430 bp deletion beginning at Chromosome 11 position 33,517,830 bp and ending after 33,518,259 bp (GRCm38/mm39). This mutation deletes ENSMUSE00000101276 (exon 4) and 362 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 58 and early truncation 50 amino acids later. There is a single bp A at the deletion site. |
