| Primary Identifier | MGI:7427577 | Allele Type | Endonuclease-mediated |
| Gene | Pstpip2 | Strain of Origin | Not Specified |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | CRISPR/Cas9 technology, using an sgRNA (targeting AGATGATCCTGATTACTCTG) and an ssODN template, generated a TAC to TTT change resulting in a tyrosine to phenylalanine substitution at amino acid 323 (p.Y323F) in exon 14. In addition, sequence of BspEI restriction cleavage site was introduced by changing the second T to G in the TCCTGA sequence. Western blot analysis confirmed expression of normal levels of mutant protein in neutrophil lysates. |
