|  Help  |  About  |  Contact Us

Allele : Pstpip2<em4Tbrd> proline-serine-threonine phosphatase-interacting protein 2; endonuclease-mediated mutation 4, Tomas Brdicka

Primary Identifier  MGI:7427582 Allele Type  Endonuclease-mediated
Gene  Pstpip2 Strain of Origin  Not Specified
Is Recombinase  false Is Wild Type  false
molecularNote  CRISPR/Cas9 technology, using an sgRNA (targeting ACTTCTTCCGGAATGCACTG) and an ssODN template, generated a TGG to GCA change resulting in a tryptophan to alanine substitution at amino acid 232 (p.W232A) in exon 10. This change prevents interaction with PEST phosphatases. In addition, sequence of NsiI restriction cleavage site was introduced by changing a C to T in the ATGCAC sequence. Western blot analysis indicated reduced protein levels in neutrophil lysates compared to wild-type protein levels.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Pstpip2<W232A>,
  • Pstpip2<W232A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele