| Primary Identifier | MGI:7413214 | Allele Type | Endonuclease-mediated |
| Attribute String | Conditional ready, Modified regulatory region | Gene | Rr338 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | The Gata3 T cell and thymic NK cell enhancer (7.1 kb KpnI-SalI T cell element) was targeted with sgRNAs (targeting GACAAATCCCAATATAGCTGAGG and GGAAGCCAGAAGTTGCTATCAGG) and two ssODNs (containing loxP site sequence plus EcoRI restriction site inside the respective sgRNA target sequences in addition to 60 bp left and right homology arms) using CRISPR/Cas9 technology, resulting in its deletion. |
