| Primary Identifier | MGI:7439819 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrrc28 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGTGAGAAGAGTGATGAG and CAAACAGAGCTTGTATTAGC, which resulted in a 1450 bp deletion beginning at Chromosome 7 position 67,617,757 bp and ending after 67,619,206 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000200384, ENSMUSE00000200380 (exons 4 and 5) and 1274 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 70 and early truncation 13 amino acids later. |
