|  Help  |  About  |  Contact Us

Allele : Rr387<em1Zyliu> regulatory region 387; endonuclease-mediated mutation 1, Zhiyong Liu

Primary Identifier  MGI:7440065 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr387
Is Recombinase  false Is Wild Type  false
molecularNote  Atoh1 enhancer Eh1 or E0 was targeted with sgRNAs (targeting AGTGGAAGCTCTGCTCACCG and AGGAGACTGGATCTCCAAGC) using CRISPR/Cas9 technology, resulting in a 2024 bp deletion (chr6:64709990-64712013 (GRCm39)) including the enhancer.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • E0 KO,
  • E0 KO,
  • Eh1<->,
  • Eh1<->
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

5 Publication categories

Trail: Allele