|  Help  |  About  |  Contact Us

Allele : Rr388<em1Zyliu> regulatory region 388; endonuclease-mediated mutation 1, Zhiyong Liu

Primary Identifier  MGI:7440077 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr388
Is Recombinase  false Is Wild Type  false
molecularNote  Atoh1 enhancer Eh2 or E3 was targeted with sgRNAs (targeting AGAGGGATCAAAGTATCTAT and GTGCATAGCACTTCCATAGT) using CRISPR/Cas9 technology, resulting in a 3033 bp deletion (chr6:64774177-64777209 (GRCm39)) including the enhancer. This allele was created in cells that already carry the Rr387em1Zyliu Atoh1 enhancer Eh1 or E0 deletion allele.
  • mutations:
  • Intergenic deletion
  • synonyms:
  • E3 KO,
  • Eh2<->,
  • Eh2<->,
  • E3 KO
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

5 Publication categories

Trail: Allele