| Primary Identifier | MGI:7440077 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr388 |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Atoh1 enhancer Eh2 or E3 was targeted with sgRNAs (targeting AGAGGGATCAAAGTATCTAT and GTGCATAGCACTTCCATAGT) using CRISPR/Cas9 technology, resulting in a 3033 bp deletion (chr6:64774177-64777209 (GRCm39)) including the enhancer. This allele was created in cells that already carry the Rr387em1Zyliu Atoh1 enhancer Eh1 or E0 deletion allele. |