| Primary Identifier | MGI:7444921 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Sppl2b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CTGCACAGGGGCCACTCTAC targeting the 5' side and AGCCACAGGGTATGACACGG targeting the 3' side of a critical region (ENSMUSE00000305070, ENSMUSE00000305063, ENSMUSE00000304985, and ENSMUSE00000305049). This resulted in a 1,246-bp deletion of Chr10 from 80698362 to 80699607 (GRCm39). |
