| Primary Identifier | MGI:7464269 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Got2 |
| Strain of Origin | either: C57BL/6J or (C57BL/6 x C3H)F1 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology with the aim to create a p.R337G mutation. The actual result was an unintended insertion/duplication of a single T (A on forward strand, after chr8:96596111 (GRCm39)), which results in a frameshift and premature stop codon. |
