|  Help  |  About  |  Contact Us

Allele : Got2<em2Pcamp> glutamatic-oxaloacetic transaminase 2, mitochondrial; endonuclease-mediated mutation 2, Philippe Campeau

Primary Identifier  MGI:7464270 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Got2
Strain of Origin  either: C57BL/6J or (C57BL/6J x C3H/HeJ)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Exon 8 was targeted with an sgRNA (targeting TCCTGACTTCTCCAGACTTG) and an ssODN template (CCGTCCCCTGTATTCCAACCCACCTCTCAATGGGGCCCGGATCGCAGCAACCATTCTGACGTCTCCGGATTTAGGTAAGCAATGGTAACGATTACTAGCTGTTCCGTGCTACAGCTCCATGAATGGAAAAG) using CRISPR/Cas9 technology to change arginine codon 337 (CGG) to glycine (GGT) (p.R337G, c.1009_1011CGG>GGT). The equivalent human mutation (p.Arg337Gly c.1009C>G) is found in some Malate-Aspartate Shuttle (MAS)-Related Encephalopathy patients.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Got2<emhR337G>,
  • Got2<emhR337G>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele