| Primary Identifier | MGI:7446962 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Clba1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCACATCTAAAACCCTGTCG and CTTAGCTCGGAACTGCGCCG, which resulted in a 378 bp deletion beginning at Chromosome 12 position 112,774,279 bp and ending after 112,774,656 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000306390 (exon 2) and 241 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 140 and early truncation 1 amino acids later. |
