| Primary Identifier | MGI:7446978 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Dhx57 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACAGTATTGCTCCTAGGGAC and AGATGAAACCAGCAACTGAA, which resulted in a 1411 bp deletion beginning at Chromosome 17 position 80,274,741 bp and ending after 80,276,151 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000251581 and ENSMUSE00000251553 (exons 4 and 5) and 386 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 129 and early truncation 11 amino acids later. |
