|  Help  |  About  |  Contact Us

Allele : Atoh1<em2Zyliu> atonal bHLH transcription factor 1; endonuclease-mediated mutation 2, Zhiyong Liu

Primary Identifier  MGI:7446983 Allele Type  Endonuclease-mediated
Attribute String  Epitope tag, Reporter Gene  Atoh1
Strain of Origin  C57BL/6 Is Recombinase  false
Is Wild Type  false
molecularNote  The gene was targeted with an sgRNA (targeting CGCGCGCTAGGAAGGGCATT) and a double strand DNA template using CRISPR/Cas9 technology to insert the following immediately upstream of the stop codon in the single-exon gene: three copies of sequence coding for a V5 epitope tag, sequence coding for the P2A self-cleaving peptide and the tdTomato fluorescent reporter gene. This allele will express both the endogenous gene, with C-terminal V5 tags, and the reporter gene.
  • mutations:
  • Insertion
  • synonyms:
  • Atoh1-3*V5-P2A-Tdtomato,
  • Atoh1-Tdtomato KI,
  • Atoh1-Tdtomato KI,
  • Atoh1<em1Zyliu>,
  • Atoh1-3*V5-P2A-Tdtomato,
  • Atoh1<em1Zyliu>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele