|  Help  |  About  |  Contact Us

Allele : Reep3<em1(IMPC)Tcp> receptor accessory protein 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7465002 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Reep3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AGCACCTATACTGACTCCGG targeting the 5' side and GTCATAATCACTAAGAGGTT targeting the 3' side of a critical region (ENSMUSE00000367558 and ENSMUSE00000575837). This resulted in a 1,710-bp deletion of Chr10 from 66870185 to 66871894 (GRCm39).
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele