| Primary Identifier | MGI:7464720 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Best3 |
| Inheritance Mode | Not Specified | Is Recombinase | false |
| Is Wild Type | false | Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTTGGGTGCATAACACCCGG and AATACTTCCAAGGAGCCTGA, which resulted in a 469 bp deletion beginning at Chromosome 10 position 117,002,370 bp and ending after 117,002,838 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000101368 (exon 5) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 161 and early truncation 54 amino acids later. |
