|  Help  |  About  |  Contact Us

Allele : Lgals3<em1Vari> lectin, galactose binding, soluble 3; endonuclease-mediated mutation 1, van Andel Research Institute

Primary Identifier  MGI:7464949 Allele Type  Endonuclease-mediated
Attribute String  Not Specified Gene  Lgals3
Strain of Origin  (C57BL/6J x C3H/HeJ)F1 Is Recombinase  false
Is Wild Type  false
molecularNote  Arginine codon 200 (AGA) in exon 5 was changed to serine (TCA) (p.R200S) using two sgRNAs (targeting CACCTTTGCCACTCTCAAAGGGGA and AAACTCCCCTTTGAGAGTGGCAAA) and an ssODN template with CRISPR/Cas9 technology. The mutation disrupts Lgals3 glycan-binding.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Lgals3<tm1Vari>,
  • Lgals3-R200S<KI>,
  • Lgals3-R200S<KI>,
  • Lgals3<tm1Vari>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele