|  Help  |  About  |  Contact Us

Allele : Mdm2<1m1.1Dwg> transformed mouse 3T3 cell double minute 2; targeted mutation 1.1, David W Goodrich

Primary Identifier  MGI:7485930 Allele Type  Targeted
Attribute String  Humanized sequence Gene  Mdm2
Transmission  Germline Strain of Origin  129S6/SvEvTac
Is Recombinase  false Is Wild Type  false
molecularNote  Exons 10-12 were targeted with a modified BAC that contains an FRT site flanked neomycin resistance gene cassette in intron 9 and an exon 12 where leucine codon 466 (CTA) was changed to alanine (GCA) (p.L466A). Recombination was aided by CRISPR/Cas9 editing with an sgRNA (targeting GCATTGTTCACGGCAAGACTGG). The neo cassette was removed through subsequent Flp-mediated recombination. The mutation is the equivalent of the human p.L468A mutation that abolishes human MDM2 (HDM2)-mediated p53 multi-monoubiquitination and HDM2-MDM4 mediated p53 polyubiquitination.
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • Mdm2<L466A>,
  • Mdm2<la>,
  • Mdm2<la>,
  • Mdm2<L466A>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

3 Publication categories

Trail: Allele