|  Help  |  About  |  Contact Us

Allele : Spag5<em1Svap> sperm associated antigen 5; endonuclease-mediated mutation 1, Svante Paabo

Primary Identifier  MGI:7470781 Allele Type  Endonuclease-mediated
Attribute String  Humanized sequence Gene  Spag5
Strain of Origin  C57BL/6NCrl Is Recombinase  false
Is Wild Type  false
molecularNote  Proline codon 43 (CCC) was changed to serine (AGT) (p.P43S), glutamic acid codon 164 (GAA) to glycine (GGC) (p.E164G) and aspartic acid codon 380 (GAC) to histidine (CAC) (p.D380H) using sgRNAs (targeting GCACAGGTATGGGGTCAGCG, AAGCTCTCTAAATGAATCTT and AGGACAGTACTTCAGAGACA) and ssODN templates with CRISPR/Cas9 technology. These mutations change the mouse residues to the residues found in the orthologous human gene (S43, G162, H410).
  • mutations:
  • Nucleotide substitutions
  • synonyms:
  • hSPAG5,
  • hSPAG5
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele