|  Help  |  About  |  Contact Us

Allele : Rr400<em1Pqt> regulatory region 400; endonuclease-mediated mutation 1, Paul Q Thomas

Primary Identifier  MGI:7447461 Allele Type  Endonuclease-mediated
Attribute String  Modified regulatory region Gene  Rr400
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  The Nestin enhancer in intron 2 was targeted with two sgRNAs (targeting TTTGCGGTCTGAAAAGGATT and AGAATCGGCCTCCCTCTCCG) using CRISPR/Cas9 technology, resulting in a 255 bp deletion (chr3:87881638-87881892 (GRCm39)).
  • mutations:
  • Intragenic deletion
  • synonyms:
  • -255,
  • -255
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

2 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele