| Primary Identifier | MGI:7485808 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Trex1 |
| Strain of Origin | C57BL/6 | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | Aspartic acid codon 18 (GAC) was changed to asparagine (AAT) (p.D18N) using an sgRNA (targeting CCACTGGCCTGCCTTCGTCT) and an ssODN template with CRISPR/Cas9 technology. The equivalent human mutation is associated with familial chilblain lupus (FCL). |
