| Primary Identifier | MGI:7466984 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Zfp524 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAGATACTGGGGTACACGG and CTAGGGAGATGTGTGAGATG, which resulted in a 1202 bp deletion beginning at Chromosome 7 position 5,017,385 bp and ending after 5,018,586 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000538365 (exon 2) and 151 bp of flanking intronic sequence including the splice acceptor start site and splice donor and is predicted to result in a null allele. |
