| Primary Identifier | MGI:7467316 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Lrfn5 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes / injecting Cas9 mRNA with single guide RNAs with spacer sequences AAGAACTGTGGAGCTACGGC and GTATTGCTTCCAATCCGGCA targeting within exon ENSMUSE00000614088. This resulted in a 919bp deletion of Chr12 from 61886383 to 61887301 (GRCm39) introducing a frameshift and premature stop codon. |
