| Primary Identifier | MGI:7450918 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Tpcn2 |
| Inheritance Mode | Dominant | Strain of Origin | C57BL/6J |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 194 (CGG) in exon 6 was changed to cysteine (TGC) (p.R194C) using an sgRNA (targeting AGAAGACCCTGAAGTGTATACGG) and an ssODN template with CRISPR/Cas9 technology. This mutation is the equivalent of the human p.R210C mutation found in an albinism patient. |
