|  Help  |  About  |  Contact Us

Allele : Exo1<em1Wed> exonuclease 1; endonuclease-mediated mutation 1, Winfried Edelmann

Primary Identifier  MGI:7468985 Allele Type  Endonuclease-mediated
Attribute String  Hypomorph Gene  Exo1
Strain of Origin  C57BL/6J Is Recombinase  false
Is Wild Type  false
molecularNote  Aspartic acid codon 173 (GAC) was changed to alanine (GCC) (p.D173A) using an sgRNA (targeting GACTCTGACCTCCTCGCATTTGG) and an ssODN template with CRISPR/Cas9 technology. The highly conserved mutated residue is located in the exonuclease site.
  • mutations:
  • Single point mutation
  • synonyms:
  • EXO1<D173A>,
  • Exo1<DA>,
  • EXO1<D173A>,
  • Exo1<DA>
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

0 Carried By

0 Driven By

2 Publication categories

Trail: Allele