| Primary Identifier | MGI:7481929 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Rab9b |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATCAAGTACCATCTAAGTG and TTATGTAAGTACATTGTCAG, which resulted in a 3744 bp deletion beginning at Chromosome X position 136,858,051 bp and ending after 136,861,794 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000409412 (exon 3) and 199 bp of flanking intronic sequence including the splice acceptor and start site and is predicted to result in a null allele. |
