|  Help  |  About  |  Contact Us

Allele : Scaf8<em1(IMPC)J> SR-related CTD-associated factor 8; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7481978 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Scaf8
Inheritance Mode  Not Specified Is Recombinase  false
Is Wild Type  false Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGAGACTAAAATAGTTCAG and GTTCACACGCTATAGGGCAG, which resulted in a 457 bp deletion beginning at Chromosome 17 position 3,162,731 bp and ending after 3,163,187 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000345755 (exon 5) and 303 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 107 and early truncation 3 amino acids later. There is a 4 bp insertion (CTTC) at the deletion site.
  • mutations:
  • Insertion,
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele