| Primary Identifier | MGI:7486741 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | D630039A03Rik |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTATCGGTTCCACACACAT and TGGTTGCTCATTAAGCCAGC, which resulted in a 8032 bp deletion beginning at Chromosome 4 position 57,908,342 bp and ending after 57,916,373 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000438436 and ENSMUSE00000438430 (exons 1 and 2) and 5202 bp of flanking intronic sequence including the start site, splice acceptor and donor and is predicted to result in a null allele. |
