| Primary Identifier | MGI:7482623 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Ugt2b38 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of AATTCTGGTCAGGGTACTCA targeting the 5' side and CTATAGGCTGGCCCATTGTC targeting the 3' side of a critical region (ENSMUSE0000105763 and ENSMUSE00001085011). This resulted in a 3841bp deletion of Chr5 from 87566792 to 87570632 with the insertion of aaaaaagaaagaaaaagaa (GRCm39), introducing a frameshift and premature stop codon. |
