| Primary Identifier | MGI:7510160 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tgoln1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGCTTACCACAACAAACGAA and GCGTCTCTCTTATAAACGGA, which resulted in a 916 bp deletion beginning at Chromosome 6 position 72,615,524 bp and ending after 72,616,439 bp (GRCm38/mm10). This mutation deletes 916 bp from ENSMUSE00000431829 (exon 2) and is predicted to cause a change of amino acid sequence after residue 19 and early truncation 24 amino acids later. |
