| Primary Identifier | MGI:7488533 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Asxl1 |
| Strain of Origin | C57BL/6N | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | An extra G nucleotide was inserted in exon 13 (ENSMUST00000109790:c.1925dupG) using two sgRNAs (targeting GGCCACCACTGCCATCGGAG and GTGGTAACCTCTCGCCCCTC) and ssODN template with CRISPR/Cas9 technology, resulting in a reading frame shift and premature stop codon shortly thereafter. This mutation is the equivalent of a human p.G643Wfs*12 mutation associated with acute myeloid leukemia (AML). |
