| Primary Identifier | MGI:7539196 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tex47 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGTCTTTCATGGTCCATAAT and GCCACACAATATCGGAATCC, which resulted in a 713 bp deletion beginning at Chromosome 5 position 7,304,836 bp and ending after 7,305,548 bp (GRCm38/mm10). This mutation deletes 713 bp from ENSMUSE00000554423 (exon 2) and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 34 amino acids later. |
