| Primary Identifier | MGI:7539172 | Allele Type | Endonuclease-mediated |
| Attribute String | Humanized sequence | Gene | Pik3r1 |
| Strain of Origin | C57BL/6JAusb | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The exon/intron 11 splice donor site was targeted with an sgRNA (targeting GGAGTACACCCGTACTTCCCAGG) and an ssODN template using CRISPR/Cas9 technology, resulting in a G-to-A substitution that changes the G-GT splice site to G-AT, which leads to skipping of in-frame exon 11, which encodes part of the inter-SH2 domain. This mutation is the equivalent of a human splice donor mutation associated with PASLI (p110delta-activating mutations causing senescent T cells, lymphadenopathy, and immunodeficiency) like disease or activated PI3Kdelta syndrome 2. |
