| Primary Identifier | MGI:7489687 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr108735 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | CTCF-binding sequence downstream of Tbx5 lung enhancer Rr426, located downstream of the gene, was targeted with sgRNAs (targeting GCATGCTGGGGTAAGCCCGAGGG and GCTGGGGTGCCAAGCCCAGAGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in an 1135 bp deletion (chr5:120240528-120241662 (GRCm39)). |
