|  Help  |  About  |  Contact Us

Allele : Ankrd42<em1(IMPC)J> ankyrin repeat domain 42; endonuclease-mediated mutation 1, Jackson

Primary Identifier  MGI:7539152 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Ankrd42
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NJ
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGAATCTCACCAGAATACTG and GTTAATGTGTTCAGATCAAT, which resulted in a 575 bp deletion beginning at Chromosome 7 position 92,619,292 bp and ending after 92,619,866 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001245987 (exon 5) and 439 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 2 amino acids later.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

2 Publication categories

Trail: Allele