| Primary Identifier | MGI:7539347 | Allele Type | Endonuclease-mediated |
| Gene | Epcam | Strain of Origin | FVB/NJ |
| Is Recombinase | false | Is Wild Type | false |
| molecularNote | Arginine codon 80 (AGG) in exon 4 was changed to glutamine (CAG) (p.R80Q) using sgRNAs (targeting GAGGAGGATAAAGCCCGAAG and TGACTCACAGCAAGTCTGGG) and an ssODN template with CRISPR/Cas9 technology. R80 is essential for matriptase-mediated cleavage of the encoded peptide. |