| Primary Identifier | MGI:7489863 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Del(5Rr426-Rr108735)1Axvi |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | A region containing Tbx5 lung enhancer Rr426, located downstream of the gene, and CTCF-binding sequence Rr108735 downstream of it, was targeted with sgRNAs (targeting ACTGGAAATCAAGACTGGGCAGG, GGAAACTGGAAATCAAGACTGGG, GGTCAGAGTCTGCCGCCCAAAGG and AAGGCCTGAGAGCGCGCCAGTGG) using CRISPR/Cas9 technology, resulting in a 1950 bp deletion (chr5:120239699-120241648 (GRCm39)). |
