| Primary Identifier | MGI:7489587 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr51 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The topologically associating domain (TAD) boundary region or insulator between Tbx5 and Rbm19, separating the Tbx5 TAD from the Lhx5 TAD, was targeted with sgRNAs (targeting AGATCTAAGACAGCCATGACAGG, CACTTTAGTAAAGTGTTGGGTGG, TTACACACCAATAATTGGGGGGG and CATAGGATACAGATATGTTGAGG) using CRISPR/Cas9 technology, resulting in a 21118 bp deletion (chr5:120225179-120246296 (GRCm39)). |