| Primary Identifier | MGI:7489592 | Allele Type | Endonuclease-mediated |
| Attribute String | Modified regulatory region | Gene | Rr50 |
| Strain of Origin | FVB | Is Recombinase | false |
| Is Wild Type | false |
| molecularNote | The topologically associating domain (TAD) boundary region or insulator between Snx13 and Ahr, separating the Twist1 TAD from the Ahr TAD, was targeted with sgRNAs (targeting GGGCACTGGGTTTCTTCTATCGG, TATTGCCTCAATGGAATAGGTGG, AGTAAGCAATGGTTTTGCATTGG and GTCTCTGACACTTGTTTGCTTGG) using CRISPR/Cas9 technology, resulting in a 13112 bp deletion (chr12:35231340-35244451(GRCm39)). |
