|  Help  |  About  |  Contact Us

Allele : Jade3<em1(IMPC)Tcp> jade family PHD finger 3; endonuclease-mediated mutation 1, The Centre for Phenogenomics

Primary Identifier  MGI:7490169 Allele Type  Endonuclease-mediated
Attribute String  Null/knockout Gene  Jade3
Inheritance Mode  Not Specified Strain of Origin  C57BL/6NCrl
Is Recombinase  false Is Wild Type  false
Project Collection  IMPC
molecularNote  This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATTTCCAGGCCGTGCTCAA and AAGCTTCTGTGCCCGTAGGC targeting within exon ENSMUSE00000326487. This resulted in a 161bp deletion of ChrX from 0377309 to 20377469 (GRCm39), introducing a frameshift and premature stop codon.
  • mutations:
  • Intragenic deletion
Quick Links:
 
Quick Links:
 

1 Feature

Trail: Allele

Genome

0 Expresses

0 Mutation Involves

Phenotype

Mouse alleles --> Mammalian phenotypes (MP terms)

 

Other

1 Carried By

Trail: Allele

0 Driven By

3 Publication categories

Trail: Allele