| Primary Identifier | MGI:7490169 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Jade3 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of CATTTCCAGGCCGTGCTCAA and AAGCTTCTGTGCCCGTAGGC targeting within exon ENSMUSE00000326487. This resulted in a 161bp deletion of ChrX from 0377309 to 20377469 (GRCm39), introducing a frameshift and premature stop codon. |
