| Primary Identifier | MGI:7490176 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Tomt |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NCrl |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCCAATGGTCAAGCGTGGTG and AGCCACATGGGCCCTGTTAA within exon ENSMUSE00000671717. This resulted in a 15bp deletion of Chr7 from 101551254 to 101551268 (GRCm39) and a 1bp deletion of Chr 7 at 101551228, introducing a frameshift and premature stop codon. |
