| Primary Identifier | MGI:7491744 | Allele Type | Endonuclease-mediated |
| Attribute String | Null/knockout | Gene | Nudcd1 |
| Inheritance Mode | Not Specified | Strain of Origin | C57BL/6NJ |
| Is Recombinase | false | Is Wild Type | false |
| Project Collection | IMPC |
| molecularNote | This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTATATACAGAGATAATAAA and AGATTGCTGTCAATATTTTG, which resulted in a 668 bp deletion beginning at Chromosome 15 position 44,399,798 bp and ending after 44,400,465 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000252601 (exon 6) and 460 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 272 and early truncation 5 amino acids later. |
